You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
yomL [2018-02-10T16:05:24.000Z]
Genomic Context
categories
[category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage][category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]The protein
Paralogous protein(s)
[protein|D04CF5261C840E9A1BC7FFE5B6F492A46EC0971C|YddT] (the two proteins differ in only 4 out of 228 amino acids)Biological materials
Mutant
BP118 (yomL::kan), available in [SW|Fabian Commichau]'s lab [Pubmed|24178028]BKE21320 (Δ[gene|25ACC4472A56ABF9F0FCA75CC24579FBC59E4C2F|yomL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGAAATCCTCCTTGTG, downstream forward: _UP4_TAATTTTAAAATCACTTTGTBKK21320 (Δ[gene|25ACC4472A56ABF9F0FCA75CC24579FBC59E4C2F|yomL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGAAATCCTCCTTGTG, downstream forward: _UP4_TAATTTTAAAATCACTTTGTExpression vector
IPTG inducible expression of Strep-''yomL'' in ''E. coli'': pGP2580 (in [SW|pGP172]), available in [SW|Jörg Stülke]'s labReferences
17114254,23420519,24178028